+55 (61) 9 7400-2446

Destaques

O que falta para o Brasil ter startups bilionárias?

O que faz de uma startup um unicórnio? Como entrar para o seleto clube de empresas que valem mais de US$ 1 bilhão e se juntar a nomes como Uber, Xiaomi, Airbnb, Snapchat, Spotify e Lyft, entre tantos outros? Aqui no Brasil, quanto valem e quanto faturam as maiores startups?

Para debater sobre o assunto, representantes do Mercado Livre, Movile, PSafe e RedPoint Ventures participaram de um painel no GMIC São Paulo 2016, evento que aconteceu dia 24 de agosto na capital paulistana e reuniu importantes nomes do mercado mobile do mundo.

Crescimento

Stelleo Tolda, COO do Mercado Livre, diz que há 17 anos, quando a empresa surgiu, o mercado online ainda era muito pequeno, o que fez com a empresa desde o começo precisasse “desbravar” a até então novidade que era a internet.

“O que para nós hoje é comum, como comprar pelo computador ou celular, naquela época simplesmente não existia. Tentávamos uma penetração em 3% da população com acesso a internet”, diz.

Desde o tempo da internet discada, entretanto, Stelleo afirma que a empresa passou por inúmeras etapas, tornando a capacidade de se adaptar a mudanças parte essencial do Mercado Livre.

“Há pouco mais de dez anos a Movile era uma empresa pequena, com duas pessoas apenas em uma incubadora de Campinas com alguns projetos de inovação e com algumas ideias de fazer uma empresa um pouco maior”, diz Fabricio Bloisi, CEO e fundador da Movile.

Até cerca de sete anos atrás, ele afirma que a startup faturava poucos milhões de reais e, de lá pra cá, a empresa cresceu mais de 150 vezes em faturamento. “A gente vende hoje bem mais que um bilhão de dólares por ano, e a gente está só começando”, garante.

Para Fabricio, o Brasil deveria ter, no mínimo, quatro ou cinco unicórnios de mais de dez bilhões de dólares. Mas por que não tem? De acordo com ele, a culpa é do governo e do mercado mas, principalmente, do próprio ecossistema.

“Será que nós não estamos pensando muito pequeno? O que nós estamos fazendo para criar as próximas empresas de bilhões de dólares no Brasil? Na China existem empresas de 200, 300 bilhões de dólares. Nos Estados Unidos, empresas de 600 bilhões. É patético que tenhamos na América Latina inteira uma única empresa de sete bilhões de dólares, que é o caso do Mercado Livre”, completa.

Marco De Mello, CEO e fundador da PSafe, diz que a primeira barreira que as empresas brasileiras devem derrubar se quiserem se tornar unicórnios é o complexo de vira-lata.

“As pessoas não podem ter vergonha de dizer ‘nós somos uma empresa brasileira e crescemos aqui com muito sucesso’. Isso lá fora não existe. Nós chegamos aos Estados Unidos e tivemos lá uma receptividade fantástica, o usuário americano tem um engajamento maior com a nossa plataforma do que o brasileiro”, diz, ressaltando o orgulho de dizer que no Brasil estão sendo criadas grandes empresas de mobile e de tecnologia de ponta. Hoje, a PSafe conta com mais de 80 milhões de downloads.

Copycats e canibalização

É muito comum, em qualquer segmento, que formatos de sucesso sejam copiados e reproduzidos, mas, no mundo do empreendedorismo, copiar o modelo de uma empresa inovadora e de sucesso não garante que ela também será bem-sucedida.

Uma coisa que deve ser levada em conta na hora de se inspirar em algo que está dando certo é a diferença da realidade de ambas as empresas. Não é porque algo dá muito certo no Vale do Silício que também dará aqui no Brasil, porque os mercados são diferentes.

“O Mercado Livre atua em 19 países dentro da América Latina, e as situações dentro de cada um deles são diferentes. Eu não vejo nenhum problema em ter como referência quem tem êxito lá fora (referindo-se ao eBay), mas hoje somos muito diferentes do que ele é”, diz Stelleo.

A lição que o Mercado Livre dá para as empresas que têm medo da canibalização é não se deixar intimidar e ter um modelo que permita que a startup se torne um unicórnio e atinja o mundo inteiro.

Anderson Thees, diretor da RedPoint Venures, diz que o termo copycat é realmente utilizado de forma pejorativa, mas na maioria das vezes de forma injusta.

Como exemplo disso, ele cita o caso do Peixe Urbano, que foi taxado como cópia do Groupon, que já fazia sucesso no mundo inteiro. De fora, o Groupon aprendeu muita coisa com o que o Peixe Urbano estava fazendo no Brasil para poder entrar no mercado Brasileiro.

“O que eu acho mais injusto é que o Peixe Urbano foi chamado de copycat, enquanto os que faziam a mesma coisa que o Groupon nos Estados Unidos eram chamados de concorrentes”, diz Anderson.

Investimento

Para que uma startup se torne um unicórnio, é preciso que todos os envolvidos no projeto trabalhem em sintonia, sejam eles colaboradores, empreendedores ou investidores – e que estes últimos estejam dispostos a assumir risco, porque é assim que ideias inovadores são colocadas em prática para que haja disrupção no mercado em que atuam.

Para ajudar a desenvolver as empresas brasileiras em busca do unicórnio brasileiro, a Movile realizou 25 transações, entre investimentos, captações, aquisições e consolidações nos últimos dois anos e meio.

“Se eu pudesse dar um conselho pra vocês, este conselho seria: é muito importante crescer rápido, ganhar escala rápido, tornar a empresa maior para você poder ter um poder de mercado forte”, diz Fabricio.

Na primeira transação da Movile, ela se fundiu com uma empresa do mesmo porte e, assim, dobrou de tamanho, fazendo a Movile crescer cada dia mais rápido, se tornando cada vez mais agressiva.

Só a Movile já colocou cerca de R$ 200 milhões em investimento no mercado brasileiro, de acordo com Fabricio, e pretende colocar mais R$ 300 até os próximos dois anos.

Para ele, o ecossistema do país está ficando cada ano mais sofisticado, o que torna a concorrência mais acirrada, mas ainda assim traz cada vez mais oportunidades para que os empreendedores cresçam.

Fonte: Exame

forget the tie or cologneSince the NFL allowed wireless communication in regular season NFL games in 1994, quarterbacks can’t get coaches out of their heads. Insert the new valve into the opening of the ball and screw it tightly into place. cheap nfl jerseys shop Cooney played just 13 games last season, mostly in pain, and his injured knee would swell badly and keep cheap oakleys him hobbling for days after matches. A sloppy desk will send the wrong vibes to the clients. “This is nothing more than an attempt to embarrass and extort Jerry Jones.”Read the lawsuitWeckerly’s attorney says his client is in hiding. “While the CBA grants the person who occupies the position of Commissioner the ability to judiciously and fairly exercise the designated power of that position, the union did not agree to attempts to unfairly, illegally exercise that power, contrary to what the NFL has repeatedly and wrongfully claimed.”. The NFL has been using this test for over 30 years. In Jordan Reed, Washington has one of the more dangerous and speedy tight ends in the NFL. And sorry, Jon Gruden I think you’ll have to be shocked, because Christian Hackenberg’s tape raises a lot of red flags, and he won’t go in Round 1. They added that the easement was feasible and ready to be opened except for the Lents constant refusal to remove the gate, fence, stairs and deck.. However his coaching style has become an integral part of Cheap Oakleys Sale the culture in Seattle. Texas A QB Johnny Manziel: While he won’t throw in Indy, Johnny Football will be Retro Jordan 1 monitored wherever he goes as was the case at this past season’s SEC Media Days. Now with sons as they are studyingHeart of Darkness. It covers the entire northern border of the state and includes Huntsville. There, the raw talent displayed scorching fastballs, most of them wayward, but soon honed his undeniable skills to become a dominant minor league star. Digital. In our view, it could make sense for DirecTV and Apple to partner to help fend off Google. While a healthy culture is hardly an automatic guarantee of results, it’s been working out pretty well for Atlanta this year. The son was going out of his way to psychically indicate car. From 1987 1992, the NFLPA decertified and antitrust lawsuits followed (McNeil v. ETFs are typically index funds which trade close to or at their underlying asset value. They said, you wanna be a movie star, don you? And I said, I don know anything about it. Batman witnessed his parents’ murder, Harry Potter was mistreated by most of his family, Captain Kirk is a Space Holocaust survivor, etc.. That will come in time as Grandal has hit double digit home runs in each of the last two years. Gene specific primers were as follows: Gabrb1: 5′ CGGAAAAGGCCCTCAGAAA (sense) and 5′ GCATCAACCTGGACTTTGTTCA (antisense); Gapdh: 5′ GGCCTACATGGCCTCCAA (sense) and 5′ GCCTCTCTCTTGCTCTCAGTATCC (antisense); Knca1: 5′ GCAATCAAAAGCCCCCAAAC (sense) and 5′ CCACCCCCCAAATTCACAA (antisense); Opkr1: 5′ GCACATGTCCTGGCAACAATAC (sense) and 5′ GATGGAGGTGCAGTAAATCGA (antisense); Slc18a3: 5′ CACCAGTCCTTCTTCTTTTGCG (sense) and 5′ Cheap NFL Jerseys GCGGTTCATCAAGCAACACA (antisense); Sst: 5′ AAGCTGGCTGCAAGAACTTCT (sense) and 5′ AGAGGTCTGGCTGAGACAACAA (antisense).

Próximos Eventos